Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST124
Clone ID RST124
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST124
Sequence
CCGCCAAAGAACAGAGATACCAGAGAGGCCTAGAAAGGAATGATAGAAGGGGTTCTTTTGACCTGAGGGCTGCTATTGTA
TATCACACTAA
Sequence Type mRNA
Unitrap ID UNI5378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77506664..77506754 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es