Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST131
Clone ID XST131
Vector pGT1TMpfs
Project baygenomics

Sequence tag XST131
Sequence
ACACACTCGGCTCTTCCCAGCCTCTGCAGTGGCCCAGGCTCTCAGCTGCTTGTCCACTCTGTGGATCGAATGGTCAACAC
TACCTTCATCTGTACAGCCACCAACGCTGTGGGGACAGGCCGTGCTGAGCAGGTCATCCTGGTGCGAG
Sequence Type mRNA
Unitrap ID UNI9814

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20315387..20315524 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es