Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST9117
Clone ID OST9117
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST9117
Sequence
CCAATAATTTTATGTTCACAATGATATGTTTCGTTATGAAGATGAATGTTTGGTGATTCTGAACCAGAACTTGATGAAGA
GTCAGAAGATGAAGTGGAAGAGGAGCAAGAAGACAGGCAGCCGTCTCCTGAACCTGTGCAAGAGAATGCTAACAGCGCTT
ACTATGACGCACACCCCGTGACTAATGGCATAGAGGAGCCTTTAGAAGAATCCTCTCATGAACCTGAGCCTGAGCCAGAA
TCTGAAACAAAGACTGAAGAGCTGAAACCACAAGTGGAGGAGAAACACTTGGAAGAGCTGGAGGAGAAGTCGGCCACTCC
TCCTCCTGCTGAGCCTGCTTCTCTGCCTCAGGAACGCCNAAGNCGANGGTTGATGCTTNGCCAAAAGTTCAGTCTCNGCC
TCCGCGTGTTCGGGAACCGCNACCTCGAGAGCGGCCTGGTTTCCCTCCTCGAGGACCAAGGCCAGGNGTAGGAGATATGG
AACAGA
Sequence Type mRNA
Unitrap ID UNI19043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92486993..92494882 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es