Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST171
Clone ID XST171
Vector pGT1TMpfs
Project baygenomics

Sequence tag XST171
Sequence
TAGNGGTTACCNGGNNGAGTGGCCTGTGATGTGNAGNCCATCGNATGAGNTTANTAACTACGGACTTTTNCCGAGACTGC
AAAAGCGTNTNGGGAGGACGACTTTAGATATNGCAAGGTGANCTTGAAGAAGCCNTGTCCNTTCTGGAATGACNTCANCC
AGTGTGGAAGAAGAGNCTGTGCCGTCAAACCCNGCCATTCTGATNAAGTTCCTGATGGAATTAAGTCTGCGAGCTACAAG
TATTCTGAGGAAGCCAACCGCATTGAAGAATGTGAGCAAGCTGAGCGACTTGGAGCCGTGGATGAGTCTCTGAGTGAGGA
GACCCAGAAAGCTGTACTTCAGTGGACCAAGCATGATGATTCGTCAGACAGCTTCTGCGAAATTGACG
Sequence Type mRNA
Unitrap ID UNI9818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 45921368..45926304 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021831 (Ero1l) NM_015774 ERO1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1354385]

 
Come back to gene ENSMUSG00000021831


For any suggestions or comments, please send an email to unitrap@crg.es