Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST184
Clone ID XST184
Vector pGT1TMpfs
Project baygenomics

Sequence tag XST184
Sequence
TGTGTACTGTCANCAGTCAGAGCATGAGCACAGTCACTGGCGATCTGAAAAGTGTCTAGAGCAGGATCTAGCTGACTCTG
AGGTTGCAGATTTGGTAGCCCAGCACAATGAGAGCTCAGAGGGGACTCATCTTACTCCTGCTGCTTCTGGCTGTCTTCTG
TTCCACAG
Sequence Type mRNA
Unitrap ID UNI9820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103935996..103936084 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032679 (Cd59a) NM_007652 CD59a antigen Gene [Source:MGI (curated);Acc:Cd59a-001]

 
Come back to gene ENSMUSG00000032679


For any suggestions or comments, please send an email to unitrap@crg.es