Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8955
Clone ID OST8955
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8955
Sequence
TTGAATTTCATACTTAGTTACTGTATGACTTTAATAACACCAGCTAATTTCAGTACTTATGGTTTTTAGCTGGTTTCCTT
ATTTTGTATATTTTTTATTTGTAAATATTAAAAATAACTCTAGTTTCATTTGTTCATTCAGAAGANAAAATAATTTTGAT
TGCTGAATGTATCTGAAGTAATCCCTGCATTAAAATCATTTTCTATCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113926908..113927117 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040383 (Aqr) NM_009702 aquarius Gene [Source:MGI (curated);Acc:Aqr-001]

 
Come back to gene ENSMUSG00000040383


For any suggestions or comments, please send an email to unitrap@crg.es