Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8932
Clone ID OST8932
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8932
Sequence
AGGGGTCTCTGAGGGCAGTTGTTGATCGTGTGCAGGGAGGAACACGCTAATACAGCAGTTCACTGACAGTGTTANATAAA
GAGCTTTCTCAGAAAACTCCACCAAGTATGCGGTTGAAACTGATTGCGAACAACACGACGGTGGAGCGGAGGTTCAGCTC
ATGGATTGGTGGCTCTATCCTAGCATCTATGGGT
Sequence Type mRNA
Unitrap ID UNI29093

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32621541..32624256 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027671 (Actl6a) NM_019673 actin-like 6A Gene [Source:MGI (curated);Acc:Actl6a-001]

 
Come back to gene ENSMUSG00000027671


For any suggestions or comments, please send an email to unitrap@crg.es