Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0053
Clone ID GC0053
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0053
Sequence
GACATTCAGATTGATGGTGACATCTGCACGAACTCGGGTTGGCCAGNTTTCACCGATGTTGGGTTTGGCAACCTCGACTA
CAGTGAAAGCCACAATGGGCTGGGCCATCCGTGCCCAACCACCGAACACTACGCCACCATACTCAGACTGCCAGGGCTTC
ATTCTGCTGACACTGTCCTCGATGTCTTGTCTAATTTCGTAAGTTGACTCTAAGCGGAAGAGATTGAAGTTCCTCAGGAG
ATAGTCGTGCAGAGTCAAAAACTGCAGATTCAACTTGGGGAGAGCAAGGCAGCCTTCCCCAGAATAGTACTCAGTAGGGA
CGATGTTCTCATCCCATATAATTTTCTCAGTTGGATACAAAGGCATCTGATTCAGTTGCTGAATTTGAGAGATGCGGCGT
TCGTGGCGAGACACCAGCAATTCTAGAAGAAACTCTTTATCAAAAGTTGTGTCTTCATTTTTAGGGAGCGTTGGCAAGAG
GCAGAGGTATGATGCCACCTGGTGGAGTGTGTTTGACTGAGAGGCCCAA
Sequence Type mRNA
Unitrap ID UNI120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113962634..113971465 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040383 (Aqr) NM_009702 aquarius Gene [Source:MGI (curated);Acc:Aqr-001]

 
Come back to gene ENSMUSG00000040383


For any suggestions or comments, please send an email to unitrap@crg.es