Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST197
Clone ID XST197
Vector pGT1TMpfs
Project baygenomics

Sequence tag XST197
Sequence
CTCCTACAAGAGAGNAAGGNCACANACGGCTNTCTTACNCTGATGGTGATGACTGTGGCAGTGATAAGAANATATCNACT
ANCANNACACTTGTGTGCAANCCAGGTGATCTAGAAAGTGCTCCAGTGCTAAGAGCTGCAAGATCTGATGGCTGCTTCTA
TGAGTTTGAGTGGCATACGGCTGCTGCCTGTGTACTGTCGAAGACAGAAGGAGAGAACTGCACGGTCCTTGATGCCCAGG
CAG
Sequence Type mRNA
Unitrap ID UNI9823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12910139..12911622 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023830 (Igf2r) NM_010515 insulin-like growth factor 2 receptor Gene [Source:MGI Symbol;Acc:MGI:96435]

 
Come back to gene ENSMUSG00000023830


For any suggestions or comments, please send an email to unitrap@crg.es