Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8804
Clone ID OST8804
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8804
Sequence
TCTCTCTCAATACTCTTGGTTGACNTCNACAGCCCTAGTATTNTATGATGTTTACCTCGGAATACACTGATGAACAGCAG
CACCGTNACCTTTGGCCTATCCCAGTGTTAAAGCTAAATCTTCAACACAACAAACTGTTTGTGAACCAAGANGGTANCTC
CAGCAAGTGGCTTCTGACTCGGCGCATTTACTTAGTGGATGCTGTANGTGGGCGATAAAATGACCTAGGAAATCAGCCAA
GAGTAATTCGAGTTGCTACCCAGATTTCACTGAGCATACGCCTTGTACCCAACACAAAAAATGGAAACATATACACTCCC
CTACTTACCATTGCCTACAGTGACATTGACATCAAAAATGCTCATAGCCAGTCTGCGAAGATTTCCTTCTCAGTGAAGTA
TGAGATGAATCAAGGAGACGCNTCTGTGCACACAGATATTGCGTTGGGTGTGTTGGGTGGGCTGGCTGTGCTATCATCTC
TTTTGAAANACAGCNGGGATGGAAAGAAGCGCATCGGGAACCCCNTGATTGATTTACANAACAGTTATGAAAATNCCNGC
TGTACTAAGCCGGTGAATCTGGGCCAATGTNTTTTTTTTATCCATCCCCAGTNGGGGAAACANGGTCTTTAATTGGGNTT
TATTTTCCTTCCAAAA
Sequence Type mRNA
Unitrap ID UNI29100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11984464..11990968 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049488 (Tmem67) NM_177861 transmembrane protein 67 Gene [Source:MGI (curated);Acc:Tmem67-001]

 
Come back to gene ENSMUSG00000049488


For any suggestions or comments, please send an email to unitrap@crg.es