Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST235
Clone ID RST235
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST235
Sequence
GACTGTTGTATGCCTCCTCCCATTCCGGGGTGGTGCAAGTGCCCGTAGCCAACTGCAGCCTGTACCCAACCTGTGGAGAC
TGCCTCCTGGCTCGAGACCCCTACTGCGCCTGGACTGGCTCTGCCTGCAGGCTCGCTAGCCTCTACCAGCCTGATCTGGC
CTCCAGGCCATGGACCCAGGACATTGAGGGTGCCAGTGTCAAGGAACTCTGCAAGAATTCCTCATACAAGGCCCGGTTTC
TTGTG
Sequence Type mRNA
Unitrap ID UNI9826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87365675..87368898 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es