Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8764
Clone ID OST8764
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8764
Sequence
CTACAAGTGACATCTGCAACACAAATCACAAAGTTCATAAAAGAACATGTTCAACAATGCAGTTGTTGTCAAATACAAAC
CTTGTTACTATACTACACTGTTTCTTGTTCTCTACAATTCATGACTTATGTACCAGAGTACACACCAGTTATATATTGCC
AAGAATTAAGACCATAGAGACTGAGTAGATGGAAAATGCCTAATTAATACATATATTCTTGTGCCTCATATTTCACCACA
AGTACAGTGTACTGTTAGTAGTCCAAAACTGCTTTACTTTTGTAAAAACACTGGTTAATTTGTATAAGATATTATATAGC
TTTTTATGCTTTAGAGATTAAATATCATGGGGGAAACTAATTTATTTTTGTCACTTCTAGATGGTGGTACCTCTTATAAA
ATGTTTGGGGGTAGTTTGATGTCATTTCTTCTTTTAATCAAAAGCCTATTCACAAAGTGGGATATATAGATGGATAAATA
TTTAGGCTGAAAGAATTTAACTTTTATCTTTACCTTGTTTTGGCTAATTGGAAAGGTTCTAAGAAGTTTTGTTCATTTTC
TGATCATTTAAAATTCCTGTTGATTTTCTTTGTGCTTGAAAGGAATAAAATCTTTTTATCCAAACTGGTTTCCCCCATTC
CCACCCCAAATAAATACNCAAATAAATGTCCAGGTTAAATTGCCCTGA
Sequence Type mRNA
Unitrap ID UNI29102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31254122..31254813 666
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047714 (Ppp1r2) NM_025800 protein phosphatase 1, regulatory (inhibitor) subunit 2 Gene [Source:MGI (curated);Acc:Ppp1r2-001]

 
Come back to gene ENSMUSG00000047714


For any suggestions or comments, please send an email to unitrap@crg.es