Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8650
Clone ID OST8650
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8650
Sequence
TCCAGTATGGAGTGGTGGAGACTGTGAGCAAGTGAACACGGATTCGGAAACGGCAGTTGTAAATGTAACCTATTCCAGTA
AGGACCAAGCTAGACAAGCCTTAGACAAACTGAATGGATTCCANTTAGAGAACTTCACCTTGAAGGTTGCCTACATCCCA
GATGAAACTGCTGCCCATCAAAATCCCTCGCCACAGCTCCGGGGGCGCCGGGGGCCATGGCANCGGGGCTCATCCAGGCA
GGCGTCTCCAGGATCGGTGTCCAAGCAGAAACCCTGTGACCTGCCACTGCGCCTGCTGGTTCCCACCCANTTTGTTGGAG
CCATTATAGGAAAAGAAGTGCTACCATTCGCAACATCACAAAGCAGACCCAGTCTAAAATCGATGTCCATCGTAAGGAGA
ATACAGGGGCCGCGGGANAANTCCATTACTATCCTCTCTACCCCTGAANGCACCTCTGCAGCTTGTAANTCTATTCTGGA
GATTATGCATAAGGAANCTCCANATATGNATTCCCCGAAGAAATCCCTTGAANATCTTACTCACAATAACTTTGTTGGCC
GTCTCATTGGTTAAAAA
Sequence Type mRNA
Unitrap ID UNI29107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 49057397..49084759 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029814 (Igf2bp3) NM_023670 insulin-like growth factor 2 mRNA binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1890359]

 
Come back to gene ENSMUSG00000029814


For any suggestions or comments, please send an email to unitrap@crg.es