Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST227
Clone ID RST227
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST227
Sequence
GTTTTTTACACTGTTTGATTCCAGCCATAATCGCATGAAAACCTATGACACGTACGTGGGGATTGGATGGCTGATCCCTG
GAATGGACAAAGGGCTGCTGGGCATGTGTGTCGGCGAGAAGCGGATCATCACAGTCCCCCCTTTTCTGGCCTACGGGGAG
GAGGGAGAT
Sequence Type mRNA
Unitrap ID UNI9834

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 56800730..56801500 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029781 (Fkbp9) NM_012056 FK506 binding protein 9 Gene [Source:MGI (curated);Acc:Fkbp9-001]

 
Come back to gene ENSMUSG00000029781


For any suggestions or comments, please send an email to unitrap@crg.es