Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8579
Clone ID OST8579
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8579
Sequence
GCACTTTTCATGGACAACAGGTGTGGAGCTGGACATCGAGTTTACTTCTGATGGAGTTCCTGTCTTGATGCACGATAACA
CAGTAGATANGACANCAGACGGGTCTGGCCGACTATGTGATCTGACATTTGAACAAGTTAGGAAACTTAACCCTGCANCA
AATCACANACTCANAAACGAGTTCCCTGACGAAAGGATCCCTACCCTGAACGAANCTGTCACAGTANTGCCTCCGCCNTA
ACCTCACCATCTTCTCTGATGTCNANGGCCATGCAGATNTGGCTTCTGCTGCTCTACNGAATATATACACGGAAAT
Sequence Type mRNA
Unitrap ID UNI13704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 125838067..125842234 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033917 (Mir16) NM_019580 glycerophosphodiester phosphodiesterase 1 Gene [Source:MGI (curated);Acc:Mir16-001]

 
Come back to gene ENSMUSG00000033917


For any suggestions or comments, please send an email to unitrap@crg.es