Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST238
Clone ID RST238
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST238
Sequence
CCACTCTCTCGTGCTCTCCTCGCTCCCCCAAGAAGCAGGATGGCCGGGACCGTGCGCACCGCGTGCTTGCTGGTGGCGAT
GCTGCTAGGCTTGGGCTGCCTGGGACAGGCGCAGCCCCCGCCGCCTCCAGACGCCACCTGTCACCAGGTCCGTTCTTTCT
TCCAGAGACTGCAGCCCGGACTCAAATGGGTTCCAGAAACCCCTGTACCAGGATCAGATTTGCAAGTATGTCTCCCCAAG
GGCCCAACATGCTGCTCAAGAAAGAT
Sequence Type mRNA
Unitrap ID UNI9836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49936081..49967020 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055653 (Gpc3) NM_016697 glypican 3 Gene [Source:MGI (curated);Acc:Gpc3-001]

 
Come back to gene ENSMUSG00000055653


For any suggestions or comments, please send an email to unitrap@crg.es