Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8507
Clone ID OST8507
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8507
Sequence
ATGATTTGACCTACTATGAGCAANAAGAGAAGAAGAAGANGAGCCTTTTTTGTTTATGACGAAGTGAGGCCCAGACAGAA
GAACCCAGCCCTCAGAGACAAAAGAATGGAGCCAGAACCAACTGAAGAAAAAGACGTGGACGCTGATGAGGAAGACAGTA
GGAAGAAAGATGCTTCTGATGACTTAGATGATTTGAACTTCTTTAATCCCAAGAAAAAGAAGAAAA
Sequence Type mRNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713487..154714090 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es