Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB418
Clone ID XB418
Vector pGT0pfs
Project baygenomics

Sequence tag XB418
Sequence
CGCCACCTCGGCGGCGGATTCGAGGGTTTGTTGTCAGTCGTGTCAGCTGGTGACATGCCATGCCGTCCGATGGTCGCTGC
TGGGAAACTCTGAGGGCGCTCCGCAACACCAGCAAAGGCCGCCTGCGCTACGACCGCGAGTGGCTGCTGCGCTACGAGGA
TGTTTTGGAAGAATGCATGTCTCTTCCCAAACTGTCTTCTTACTCTGGATGGGTGGTAGATCACATCCTACCCAACACCT
CAGGCCACACGCAAGAGAGTGCTCCTTCTTCTGATAATTCACCATCCTCTGGATCTGCATCTGGCTTGTACCAATCCTCA
CTACTAAAATCTCCTGTCAGAAGTAGCCCACAATCCCCGTCACCCTCATCACCAAATGGAACCCAGAGCACACATGAGTC
CCCGTTCACAGAACCTATTGCACCTCAGTCCTCCCGGGCGATCAAAGTGGAAGGTTGCATCCGAATGTACGAATTGGCGC
ACAGAATGAGAGGAACA
Sequence Type mRNA
Unitrap ID UNI9847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29790961..29794125 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019715 (Gle1) NM_028923 GLE1 RNA export mediator (yeast) Gene [Source:MGI (curated);Acc:Gle1-001]

 
Come back to gene ENSMUSG00000019715


For any suggestions or comments, please send an email to unitrap@crg.es