Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB432
Clone ID XB432
Vector pGT0pfs
Project baygenomics

Sequence tag XB432
Sequence
ATCCTCTCTGCAGCTCCCATCCAGGTGGGCCAGCTTGCCCTCTTCCAGATGCCTGTGTCACTGGCCACTGGCAGCCTGCC
TACTCAGAGCCAGCCGGCTCCCACTGGCCCCACAGCCACCACCGTCCTCCAGGGCGTCACCCTGCCTCCCAGTGCTGTGG
CCATGCTTAACACGCCTGATGGGCTAGTGCAACCCTCCACTCCAGCTGCCACCACTGGGGAGGCCACACCAGTTCTGGCC
GTTCAGCCTGCAACCCAGGTGCCCCCTGCTGTCACCACACCACTGCCTATGGGTCTCCAACAGCCACAGGCACAGCAGCC
TCCACAGGTCCCTACTCCACAGGCGGCCACCCAGCCTCAGGCCACCCCTCCTCAGGCCAGCCCAAGCCTGGCTTCCAGCC
CAGAGAAGATAGTCCTGGGGCAGGCGCCCCCTGCGGCCACAACGGCCATCCTCACTCAGGATTCCCTACAGATGTTCCTG
CC
Sequence Type mRNA
Unitrap ID UNI9849

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16572832..16573313 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070808 (Gltscr1) NM_001081418 glioma tumor suppressor candidate region gene 1 Gene [Source:MGI Symbol;Acc:MGI:2154263]

 
Come back to gene ENSMUSG00000070808


For any suggestions or comments, please send an email to unitrap@crg.es