Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8086
Clone ID OST8086
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8086
Sequence
GGAAGGAAGAGGTGGGTGATACGATGGGGCCAGCCTTCGCCTCCACGCCAAGTGCCTGAACATCAGCTCCTGTTCTTCAC
CATCCTCACGGCCATCGTCGTCATCGTTGTCTGTGCCATTAGATGATGTGAGATGTCTTGCAACATCTCACAGTAGATAA
CAGATTCTGGGGCCTCCCAGGCTTGCTATGTGTTTCCTTGTCTATCGCTGCCCCAAACCCTAGACTTAGTCCTGACCATT
TGCCCCATACATATGCAAATGTGACACTCACAAATCTGTCCATGGTGGACTCAATAAAGTGCACGTGCTGTGACTTTCTG
CCCCTGGAA
Sequence Type mRNA
Unitrap ID UNI13978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148155397..148155727 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es