Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST8050
Clone ID OST8050
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST8050
Sequence
GTGGCTGGTTCGGATCCGCAGTAGCAAGAGCAGGAGCATGGATTGCGTGTGACTTTACCANGGGTTATGCAGAAATGCCT
GCCAGAAATATGAGATCCAGTACTTAAGTTGCCCAAAGACCAGGAAGTGCTGCCTCAAATATCCTAGGAAGATTACCAGC
TTCTAACTCTGTGAGGGAGCCTGGCTTGCCCACCACAAATGCTTCAAGCTACACTCAGGTTTGAATGTCACCGGCATCAT
CCCTTCTTGTAGTAATTTTTCCTATGTTCTGGAATATTGTTCTCATAAAAATCCATTCCTTCC
Sequence Type mRNA
Unitrap ID UNI14123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152364450..152364756 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044249 (Defb29) NM_001001444 defensin beta 29 Gene [Source:MGI (curated);Acc:Defb29-001]

 
Come back to gene ENSMUSG00000044249


For any suggestions or comments, please send an email to unitrap@crg.es