Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB465
Clone ID XB465
Vector pGT0pfs
Project baygenomics

Sequence tag XB465
Sequence
GCTGGGGTTTAGCAGCCATGTGAGTTCTTCGGGGTAGCGGCACCTTGAACAGT
Sequence Type mRNA
Unitrap ID UNI9855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106379626..106379678 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041506 (Rrp9) NM_145620 RRP9, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2384313]

 
Come back to gene ENSMUSG00000041506


For any suggestions or comments, please send an email to unitrap@crg.es