Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7921
Clone ID OST7921
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7921
Sequence
GAGATCTTTGCAAAGGTGTCCAAGCAGAAGCAGAACAGCACCCGGACCAGTGCCATCACCCTGGGCAATGCCCAAGCTGG
ACAGGATCCTGGCCCTGGGGAAAAGAGGGCCTGTTGCATCAGCCTCTGACTTCAGCTATGGCCAGCCCTGTGTCCTGCCT
TCAGCTTTCAGATATCTCCACCTCCCTTACTGCAGGACTTCTCCCTACCCTGGAGTCCCTGATCACTAGCACGCAGGGTC
ATCATGCCCTACCATGTGATCTGCCCACCATATTCCTCTCCATCACCTGGACCCCTTACAGGCGAGGGCCGGAAAATAAA
AGCTGTTTTGTATTGTGCCTGGCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI29076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88345950..88346293 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]

 
Come back to gene ENSMUSG00000008601


For any suggestions or comments, please send an email to unitrap@crg.es