Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7917
Clone ID OST7917
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7917
Sequence
GCGTGTTGAGGCAAAACTCAAGGAGGAATATGGAGGCTCAACATCAGCATCAGAGTCGCCACAGTCGATGCAGTCACCAC
AATCATCATCGTCATTTCCTACTATATCAGAAGACTTCAACAATGTGGAAGAGGGCTAAGGGAAGCCAGCAGTGGCCGCC
ATTCAAGAGCAACACACAGTTCAGTTGTATCAGTTTAATTGGAGCAGAGTGTTCAATTAAAAGTATATTTTGCTGTTCAT
CTTTTAAATCTTCATATCAATAAATCTTAATCATACTTCAAACGTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI29124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125809219..125809502 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027209 (4930525F21Rik) NP_083731 RIKEN cDNA 4930525F21 gene Gene [Source:MGI Symbol;Acc:MGI:1923073]

 
Come back to gene ENSMUSG00000027209


For any suggestions or comments, please send an email to unitrap@crg.es