Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB481
Clone ID XB481
Vector pGT0pfs
Project baygenomics

Sequence tag XB481
Sequence
CCTTTAAGAAGATGGCTGCGGGTGGTAACAGGGACGGTGAGAAGCGCGGCTCGAGAAGCCAGGCGGACTCTGGCTTCCTG
GGGCTGCGGCCGACCTCGGTGGATCCCGCTCTGAGGCGGCGGCGGCGGGGCCCCAGAAACAAGAAGCGCGGCTGGAGGAG
GCTCGCCGAGGAGCCGCTGGGGTTAGAGGAATT
Sequence Type mRNA
Unitrap ID UNI9860

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16531225..16531413 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041560 (Gltscr2) NM_133831 glioma tumor suppressor candidate region gene 2 Gene [Source:MGI Symbol;Acc:MGI:2154441]

 
Come back to gene ENSMUSG00000041560


For any suggestions or comments, please send an email to unitrap@crg.es