Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7636
Clone ID OST7636
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7636
Sequence
GCAGGGATTCCCAAGGATGAAGCCTTCAGCGGACGCTTGAGCCCCCCGAGCCCCAAACACAACTGTACCCTGTTACTTCT
GCTTCAGCTCTGACCTTTTCCGTCCTCTGTAAATACAATAAAACCCCCATTCTCATCTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157155232..157155372 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027643 (Ghrh) NM_010285 growth hormone releasing hormone Gene [Source:MGI (curated);Acc:Ghrh-001]

 
Come back to gene ENSMUSG00000027643


For any suggestions or comments, please send an email to unitrap@crg.es