Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7591
Clone ID OST7591
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7591
Sequence
ACGTCCTCTGAAACCAACAGTGACCAATGACAGATCATGCCCCTCTGCTCAGCTGACGGGCTCCTCTGCATCGACACTCT
GTCCCCACCTGCCAGCTGAGGGTGATCAGGGCATGTTCCTGTCCAGAGAAGACCACAATGCCCCACTCCCTAGCCTCGCC
TCACATCGGCCCAGCCTGGGCTGGATCCCAGGTGTTCCTGGTGAGGTGGCTGCCTCAAGAGGCCGATGCCCCAACAGAGG
GGCCAGCACTTGGGCAACAGGGACCTCTGATCCTAACTGTGGAACCTCGAGAGCCTCTGGACACAGAGAGGACATTCTGC
CGGCTTGCAGGGAAGGGAGCCTATTCCCATGCTGACTTTTAAACTTTTTTATCTCACGTGTGTCTGGTCAATAAACGTGT
GCTCACCATGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI29131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119867687..119868096 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025372 (Baiap2) NM_001037755 brain-specific angiogenesis inhibitor 1-associated protein 2 Gene [Source:MGI (curated);Acc:Baiap2-005]

 
Come back to gene ENSMUSG00000025372


For any suggestions or comments, please send an email to unitrap@crg.es