Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7548
Clone ID OST7548
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7548
Sequence
GAGAGGATCAGGAAGAATCTACAGAAGCGTCTGAAAANAGAGGAAGATAAANTGAAACACCAACATCTGAAGGTAACTCA
CAGTTGACTTCCATTTTCTTTCGATGGTTTTGTGTTCAAGTACCCGGGCACCGCTCGTAAACCCACCCACAGTGAAGATG
CTTTGGGGGAGAAAGATTTCCCAGTCAAGCCAATCACCTTTCTAATCACCAGAGAAGAGGCCAGGAGGCCACGGATTTGC
AAATGCGAGTAATACCTTTTAACAAACCTGGGGAAGGGTACAAACATGGTTTTATTGCTTCCTTAAGTTAGTGAAGGCTT
TCCAAACCTTGAGAACTGGGCCCCATTGCAGCCTTGTTTAACATCTCTGGGGAGTGGAGCCAGCTAGGAAGTTCCTTTTG
AAATCAATGAAAGGCCACCCTT
Sequence Type mRNA
Unitrap ID UNI29133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116655624..116656040 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033377 (Palmd) NM_023245 palmdelphin Gene [Source:MGI (curated);Acc:Palmd-001]

 
Come back to gene ENSMUSG00000033377


For any suggestions or comments, please send an email to unitrap@crg.es