Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7546
Clone ID OST7546
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7546
Sequence
GCAAGGTGAGAAAATTATTCTGGAGTTCCTGTCGAAGGTCTTGCNGGTGCCCTTTACTGCCATGTCGGAGGAGAGCATCT
CCGCGAAGCTGAAGCAACTGAAAGCCGAGGTGGTCGCAAAGAACAACAGCTTCGTAAACGAGATCATTTCACGGATAAAG
GCTCCGGCTCCGTGAGGGGACAGTGGGTGGGCGTGCNCGGGGGAGCTCACCTTTACTGTGTGCTGTTCTGGGTAGTGCTC
CCCACTGGAACCTGGCCTAGCAGCATCCGGAAGTGTTTAGTGATGCTTGAAAACATTACCGTCTGTAGCTGGGCGCTGTT
TAAATGGGGACGGGCANCTGTGAGCACTATGCTGAA
Sequence Type mRNA
Unitrap ID UNI7558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88122670..88123025 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]

 
Come back to gene ENSMUSG00000024151


For any suggestions or comments, please send an email to unitrap@crg.es