Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7541
Clone ID OST7541
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7541
Sequence
GCGCTCAGTGAGAGGGATAGAGTCAAGTTCACCCGTTCACACAAAGAGTTCATTGCCAAATTTTAAGCAAAATGAATTTT
CAGTCGTTCGACAACATGAGGAATTTATCTGGCTTCATGATTCCTTTGTTGAAAATGAAGACTATGCAGGTTACATTATC
CCACCAGCACCACCAAGACCTGATTTTGATGCTTCACGGGAAAAACTGCAGAAGCTTGGAGAAGGGGAAGGGTCGATGAC
AAAGGAAGAATTCACAAAGATGAAACAGGAACTGGAAGCTGAATACCTGGCGATCTTCAAGAAGACAGTTGCAATGCATG
AGGTGTTCCTG
Sequence Type mRNA
Unitrap ID UNI8874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55869078..55885046 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005656 (Snx6) NM_026998 sorting nexin 6 Gene [Source:MGI Symbol;Acc:MGI:1919433]

 
Come back to gene ENSMUSG00000005656


For any suggestions or comments, please send an email to unitrap@crg.es