Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7520
Clone ID OST7520
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7520
Sequence
CCGCCCTCGGATCCCGCCTTTGCCTCGCGCAGCTGACCCCGATGAGCTGATCCAGCTAGTCCTCAAACAGAAGGAGACCA
TCAGCAAGAAGGAGTTTCAGGTGCGGGAGCTGGAGGACTACATCGACAACCTGCTAGTCAGAGTCATGGAGGAGACCCCC
AACATCCTCCGAGTGCCGGCGCAGATGGGCAAGAAGGCCGGAAAGATGTAAACTGCGGGAAGGAGGCGTGGTCTGAAGGA
GGCGTGGTCTCCCTAGTAACTAGCACACCGGTTCCGAAGGCCTGCTGTGTGCATCATCTCTCAAGAGTTAATTCTCCTAG
CTGAAAACCAGATTAATGATTACAACGAATCTTTTACTATACAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI29135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28253496..28253858 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031488 (Rab11fip1) NM_001080813 RAB11 family interacting protein 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:1923017]

 
Come back to gene ENSMUSG00000031488


For any suggestions or comments, please send an email to unitrap@crg.es