Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7395
Clone ID OST7395
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7395
Sequence
TGAATCGACCAGTTTTGAGAGGAGAAGATGGGGACAAAGCGGCTCCTCCTCCTATGTCACGCACAGCTGTCTGGGATTCC
TATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCTTGGCCTTG
GCTTTCCTATGGCTCACCCACCAAATCTGGGGCCCCCACCACCTCTTCGAGTGGGTGAGCCTGTGGCGCTGTCAGAAGAA
GAACGGCTGAAGCTGGCACAGCAGCAGGCAGCTTTGCTGATGCAGCAAGAGGAGCGTGCCAAGCAGGCAGCTGTGTTAAT
GGAGCAGGAACGGCAGCAGGAGATCGCCAAGATGGGCACTGCAGTCCCTCGGCCGCCTCAGGATATGGGGCAGCTGGGTG
TCCGTACTCCTCTGGGGCCTCGCG
Sequence Type mRNA
Unitrap ID UNI21659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5291305..5294363 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024853 (Sf3b2) NM_030109 splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

 
Come back to gene ENSMUSG00000024853


For any suggestions or comments, please send an email to unitrap@crg.es