Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7358
Clone ID OST7358
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7358
Sequence
AGCTGGAAATAAAAGCTTCCAGAACAAGCACTGTGGAAAGGGGCCCCAAGCCGCACTCAACCCCAGCCGCAGCAGCGCAN
AATTCAGTGGCGCTCCAAGCTCCTCCTCCACCTGGCCATCACCTCCAGACACCTGGCCATCGTCCCTTGCCTCCAGGCCA
CCGTACCCGTGAGCACCAGCAGAAGAAGAGACCTCCTCCATCAGGCACACAGATTCACCAGCAGAAAGGCCCTCCTTTAC
CCAGACCCCGAGTTCAGCCAAAACCTCCCTGTGGGAGTGGAGATGGTGTTTCACTGCCGCCCCCTAATTAAGAAGGCAGA
GTTCGTCATTTCCAATAAAAAGCTGTGTGGATTTATCTTCA
Sequence Type mRNA
Unitrap ID UNI29149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101079831..101080190 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027863 (Cd2) NM_013486 CD2 antigen Gene [Source:MGI Symbol;Acc:MGI:88320]

 
Come back to gene ENSMUSG00000027863


For any suggestions or comments, please send an email to unitrap@crg.es