Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB538
Clone ID XB538
Vector pGT0pfs
Project baygenomics

Sequence tag XB538
Sequence
CGCCAGCTTGGGGGAGTAGCCGAGTGGTCTTGCTTCCCTGACGCCTCGGACGCGGAGTCTGTAAAAGCCAGAAGAGGAGG
TTTGATTCAGTAACTGTTTCCTCTTTTCCGGGTCGCTCTGACCCTTCTCTGGATACTGGGTTAATACACAGAAATACCGA
AGACGACGTTTGGGATTTTATTTTGTCTGTGTTTGGAATTTTACTTCTCTCTTGG
Sequence Type mRNA
Unitrap ID UNI9872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4396337..4396551 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es