Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7179
Clone ID OST7179
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7179
Sequence
GGGATTTATCAAAGATGTCCACGAAGACTCCCTCACAGTTGNTTTTGAAAATAATTGGCAACCAGAACGCCAGGTTCCGT
TTAATGAAGTGCGATTACCACCACCACCTGATATAAAAAAA
Sequence Type mRNA
Unitrap ID UNI2391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33938448..33940051 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027680 (Fxr1) NP_001106659 fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]

 
Come back to gene ENSMUSG00000027680


For any suggestions or comments, please send an email to unitrap@crg.es