Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST7107
Clone ID OST7107
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST7107
Sequence
GATAACAATGCTAGGACTAGAAGGAGACCTGAGCTGGACCCAGGATCCACTGGAGGGCGTCCTCATCTCTCTGCCACAGT
TGCCACCTACCGTTCTGCCGGTGGAGTTTGCGTGGACTCTGAAGCTGACAAAGGTGAACTGATCAAAGGAGCTCAAGGAC
AGACTGCCCGGGGCGCTGCTTACCATCCCTGCAATAAAGTAGCTTCCCTTCCTTCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 135494988..135495204 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028673 (Fuca1) NM_024243 fucosidase, alpha-L- 1, tissue Gene [Source:MGI (curated);Acc:Fuca1-001]

 
Come back to gene ENSMUSG00000028673


For any suggestions or comments, please send an email to unitrap@crg.es