Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST6798
Clone ID OST6798
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST6798
Sequence
AGGGAGCCTGACATCATGTGTCCCTGTCGATCTGGCTTGAATTGTCATTCTAAGGACCCCACATGTCCCCGCCGATGTCA
AATGATATAGAGGATGACATAGGCTGCTCATGGCCCCTGCTGCTGCACCTTCCCCTCCACAGGTGTCACCCCCATCGCCA
ACTCCACATCGACTCCTGGGCATTAAAATCACTTCCTGGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28689366..28689565 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024224 (Gm749) NP_001030043 gene model 749, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685595]

 
Come back to gene ENSMUSG00000024224


For any suggestions or comments, please send an email to unitrap@crg.es