Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST161
Clone ID RST161
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST161
Sequence
GGGGGGGGGGGGGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGGGAAGTGACGGAGCCGAGCTAGCGCGACGAGGCC
GCCTCTATGGTCTTCCTCTCCTTCTGGAGTCGGGAAATGGCCGCTGTGTAGTTAGCACGGAGGTAAACCCTGCACGCACA
TCGTGCTTCGGCGTGT
Sequence Type mRNA
Unitrap ID UNI374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20032275..20032407 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es