Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST6580
Clone ID OST6580
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST6580
Sequence
ACAAGGACCGAGAGGTTCGGCGCANGGAGCCCAAGAGCCNGGACATCTACCTGCGGCTGCTTGGCAAGCTGTACAGGTTT
CTGGCCAGACGGACCAACTCCACCTTCAATCAGGTTGTGCTGAAGAGGTTGTTCATGAGCCGAACCAACCCGGCCACCTC
TGTCCCTGTCCCGCATGANTCCNAAAGATGAAGCTTCTGGCCGCGAGAACAAGACTGCCGTGGTTGTGNGGACGGTCNCA
GATGATGTGCGGATTCT
Sequence Type mRNA
Unitrap ID UNI29180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52974642..52975369 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059070 (Rpl18) NM_009077 ribosomal protein L18 Gene [Source:MGI (curated);Acc:Rpl18-001]

 
Come back to gene ENSMUSG00000059070


For any suggestions or comments, please send an email to unitrap@crg.es