Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST6495
Clone ID OST6495
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST6495
Sequence
AGGTGTGCTGATGATGATCCTCATGTTCAGTTTTTTCCTTCCATGGCTGCATAACAACCAAATGACTAATAAAAAAGAGT
AACCACTCCCAAAGACTCGAACTAAGTCCCAGGACAGTCAAGCTGGATGCGACAATCTGAGCACCCTCCAAACTCTGGAC
GCCTCCTGCTTCAGCTTTCTCTGTGGAAGGTGTCTTAAGTTTTTACTACCTGGACTTCAAATTACTGTGAAAATGAGGTA
GCCTGTATTTCTCAAGTTAAGACTTGTTCTCGAGTGATGTATTAAATGCTGCTAGAAAAGGCTCATTCATTAAACATCTA
CCTATCCCAAAA
Sequence Type mRNA
Unitrap ID UNI24059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104874887..104875216 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042797 (Aqp11) NM_175105 aquaporin 11 Gene [Source:MGI Symbol;Acc:MGI:1913583]

 
Come back to gene ENSMUSG00000042797


For any suggestions or comments, please send an email to unitrap@crg.es