Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST317
Clone ID RST317
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST317
Sequence
TGAATCTTGTGCCAGGCTGCGATCGATATGCATCTGCTTGCCAGATGAAATATGAAAATCATGAGGGCTCCTTGGCAGAG
ACTGTATCCATCAGTAACTTGGGAGTTGCAAAGATAGGCCCTGTGGTGGAGGAGAGTGGCAGCCTCCTCTTAGAGTATGT
GAACGGCTCTGCTTGCACCACCAGTGATGGCCAGCTCACCACCTACAGCACCAGGATCCATCTTGTCTGTGGTCGAGGAT
TTATGAACTCCCATCCCATATTCACTTTCAACTGGGAATGTGTGGTCAGTTTCTTGTGGAACACGGAGGCTGCCTGCCCT
ATCCAGACAATCACAGAAACAGACCAGGCTTGCTCAATAAGGGACCCCAGCAGTGGGTTTGTGTTTAATCTTAGCCCACT
CAACGATTCTGCTCAAGGACATGTGGTCTTAGGCATCGGAAAGACTTTTGT
Sequence Type mRNA
Unitrap ID UNI9894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12903504..12907803 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023830 (Igf2r) NM_010515 insulin-like growth factor 2 receptor Gene [Source:MGI Symbol;Acc:MGI:96435]

 
Come back to gene ENSMUSG00000023830


For any suggestions or comments, please send an email to unitrap@crg.es