Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST6352
Clone ID OST6352
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST6352
Sequence
GCTGGAGCCTCCCCTGAGTCAGAAGCTGTGGAAAAGGATGAGGACTACTGGGAGGTACAGATTAGCCCAGAGTTACTGGC
ACATGGGCGCAAAAAATTATTGGATCTGCTGAATGAAGGCTCAGCTCGGGAACTGCGCAGCCTGCAGCGCATTGGCCAGA
AGAAAGCCCAGCTCATCGTGGGCTGGAGGGAGCTCCACGGCCCCTTCAGTGAGGTGGAGGACTTGGAACAGGTGGAAGGC
ATCTCTGGGAAGCAGGTGGAGTCTTTCCTGAAGGCGAATCTCTTGAGCTTGGCCGCCAGCCAGCACAAGCGGTCCCTCTT
GACACTACCTTCTTTTAAAAATCCTTGTATAGTGACGTGTTGTGTAAATACAG
Sequence Type mRNA
Unitrap ID UNI13659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134171256..134171797 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es