Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST6340
Clone ID OST6340
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST6340
Sequence
GTGGATGTCTTCAGACAAAATCTTTTNCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCCCT
GAGTCAGCTCTTGCAGGAGGATTCCCTCAATGTGGCCGACCTCTCCTCCCTCCGGGCTCCTCTGGACATCCCTATCCCAG
ATCCTCCACCCAAGGATGACGAGATGGAAACAGACAAGCAGGAGAAGAAGGAAGTCCCTAAGTGTGGCTACCTCCCGGGG
AACGAGAAGCTTCTGGCCTTGCTCGCTTTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAGTGCATTCTGGTAATCAC
ATGGATCCAGCACCTGATCCCCAAGATTGAGGATGGAAATGATTTTGGGGTGGCAATTC
Sequence Type mRNA
Unitrap ID UNI29189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56207283..56209364 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079197 (Psme2) proteasome (prosome, macropain) 28 subunit, beta Gene [Source:MGI Symbol;Acc:MGI:1096365]

 
Come back to gene ENSMUSG00000079197


For any suggestions or comments, please send an email to unitrap@crg.es