Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST271
Clone ID RST271
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST271
Sequence
AGACCGCCGGAGTCGCCGCCGGAGAGGAGTCGACTCGCCAGCCGCCGCCAGCGAGGCCCGCCCACCCGTTTGTCTGGCCC
TCTGCCCCGTTCACCAT
Sequence Type mRNA
Unitrap ID UNI2259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127496246..127496342 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85793879..85793975 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040078 (AC161888.5)  

 
Come back to gene ENSMUSG00000040078


For any suggestions or comments, please send an email to unitrap@crg.es