Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX320
Clone ID NPX320
Vector pGT1&delta
Project baygenomics

Sequence tag NPX320
Sequence
GGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCCGTGTCCTC
Sequence Type mRNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 65887225..65887270 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062610..30062655 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13380246..13380291 46
NO GENE  

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es