Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST5778
Clone ID OST5778
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST5778
Sequence
AGGACGACCCCAGCGCTCCCCACAAAATCCAGGACCCTCTCAAGTCCCGCCTGAAGGAGGAAGAGTCCTTTAACATCCAG
AACTCCATGTCACCCAAACTTGAGGGTGGCAAAGGTGACCAGGATGACTTGGGGGTGAACTGTCTGCAGAATAACCTAAC
CTGAGACTGAGGAAGAAGAGAGGAAAGGGGGGTGGGGGAGGGAAGGACTGTNGNCTCCTCTCNGNCAGAGTCNGCTTCTT
GNAACCATTNGTTAAGCNTTTCTTTNTCTGATCTCATGGCATGCTCTGATG
Sequence Type mRNA
Unitrap ID UNI28920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110164562..110164852 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032482 (Cspg5) chondroitin sulfate proteoglycan 5 Gene [Source:MGI Symbol;Acc:MGI:1352747]

 
Come back to gene ENSMUSG00000032482


For any suggestions or comments, please send an email to unitrap@crg.es