Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST5749
Clone ID OST5749
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST5749
Sequence
TGGGCTTCTCGACTATATTGTTAACCCACTGTGGGAGACGTGGGCCGATCTCGTCCACCCCGATGCCCAAGACATCCTGG
ACACGCTGGAAGACAACCGGGATTGGTATCACAGTGCCATCCGCCAGAGTCCCTCCCCAACCCTGGAAGAGGAGCCAGGA
GTGCTCAGCGATCCGGCCCTGCCTGACAAGTTCCAATTTGAGCTCACCTTGGAGGAAGAGGATGAAGAGGATTCATTGGA
GGTTCCAGGATTGCCTTGCACTGAGGAAACCCTCCTGGCTCCACATGATACCAGAGCTCAAGCCATGGAACAGTCAAAGG
TCAAAGGCCAGAGCCCTTGCT
Sequence Type mRNA
Unitrap ID UNI20710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21015139..21015476 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032177 (Pde4a) NM_019798 phosphodiesterase 4A, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99558]

 
Come back to gene ENSMUSG00000032177


For any suggestions or comments, please send an email to unitrap@crg.es