Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX381
Clone ID NPX381
Vector pGT1&delta
Project baygenomics

Sequence tag NPX381
Sequence
GCGTGCAGCTCAGGTCGGGCGCCCAAGACGAGGGGCCTCTGGCAGGCACCTG
Sequence Type mRNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17233770..17233821 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es