Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST5401
Clone ID OST5401
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST5401
Sequence
AAGCCAAGGAGCGTGAGTCCACGTCCCCTGCAGCCATGCAGCCTGTCCAGCTGCCCNGCCTGGCCTTGTCTCCACCGCTC
C
Sequence Type mRNA
Unitrap ID UNI29218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19585912..19585992 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048481 (P42pop) NM_145579 Myb protein P42POP Gene [Source:MGI Symbol;Acc:MGI:2446472]

 
Come back to gene ENSMUSG00000048481


For any suggestions or comments, please send an email to unitrap@crg.es