Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST5353
Clone ID OST5353
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST5353
Sequence
GGTCCGGTTTATCACTAAAATATGGCACCCTAATATTACGTTCCGTCACAGGGGCTATTTGTTTGGATATCCTGAAAGAT
CAATGGGCAGCAGCAATGACTCTGCGCACGGTATTATTGTCATTGCAAGCGCTGTTGGCGGCTGCAGAACCAGATGACCC
CCAAGATGCAGTAGTAGCGAATCAGTACAAACAGAATCCTGAAATGTTCAAGCAGACAGCTCGACTTTGGGCACACGTGT
ACGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAA
Sequence Type mRNA
Unitrap ID UNI1390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65972624..65985761 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]

 
Come back to gene ENSMUSG00000029203


For any suggestions or comments, please send an email to unitrap@crg.es